Transcript: Human NM_001005214.4

Homo sapiens leucine rich repeat containing 52 (LRRC52), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
LRRC52 (440699)
Length:
1372
CDS:
298..1239

Additional Resources:

NCBI RefSeq record:
NM_001005214.4
NBCI Gene record:
LRRC52 (440699)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253453 TTCGAGAGGTGATGGATTATA pLKO_005 563 CDS 100% 15.000 21.000 N Lrrc52 n/a
2 TRCN0000138458 CTGGAAGTGCAACTGCTCTTT pLKO.1 852 CDS 100% 4.950 3.465 N LRRC52 n/a
3 TRCN0000137664 GCAGCTGAACATTGCCAACAA pLKO.1 681 CDS 100% 4.950 3.465 N LRRC52 n/a
4 TRCN0000137868 CAACTGCTCTTTCCTGGACTT pLKO.1 861 CDS 100% 4.050 2.835 N LRRC52 n/a
5 TRCN0000136262 GTCTTCAAACTCATCTACCTT pLKO.1 595 CDS 100% 3.000 2.100 N LRRC52 n/a
6 TRCN0000136315 CCTTGTTTATTTGGACTGTCA pLKO.1 531 CDS 100% 2.640 1.848 N LRRC52 n/a
7 TRCN0000136415 CGAGAACAGAATCACTAGTTT pLKO.1 480 CDS 100% 0.000 0.000 N LRRC52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05672 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05672 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480486 GTTCGCTAAATCCGTTCTCCCGGC pLX_317 40.9% 100% 100% V5 n/a
Download CSV