Transcript: Mouse NM_001005358.2

Mus musculus zinc finger protein 960 (Zfp960), transcript variant 1, mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Zfp960 (449000)
Length:
2680
CDS:
75..1715

Additional Resources:

NCBI RefSeq record:
NM_001005358.2
NBCI Gene record:
Zfp960 (449000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001005358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096193 GCATGTCACAGATACCTTCAA pLKO.1 1320 CDS 100% 4.950 2.970 N Zfp960 n/a
2 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 615 CDS 100% 15.000 7.500 Y ZNF443 n/a
3 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 615 CDS 100% 15.000 7.500 Y Zfp97 n/a
4 TRCN0000365950 AGCAATCTTCTAGACCATAAA pLKO_005 585 CDS 100% 13.200 6.600 Y Zfp97 n/a
5 TRCN0000365952 AGTACTCTTCATATCCATAAA pLKO_005 669 CDS 100% 13.200 6.600 Y Zfp97 n/a
6 TRCN0000225927 CCTCACTGCCATAGGCTATAA pLKO_005 218 CDS 100% 13.200 6.600 Y Gm38396 n/a
7 TRCN0000374173 CTCACTGCCATAGGCTATAAC pLKO_005 219 CDS 100% 13.200 6.600 Y Zfp97 n/a
8 TRCN0000096191 GCTCATCTTCAATGTCATAAA pLKO.1 741 CDS 100% 13.200 6.600 Y Zfp960 n/a
9 TRCN0000365876 GTCTTATACTGATCGTCAAAT pLKO_005 410 CDS 100% 13.200 6.600 Y Zfp97 n/a
10 TRCN0000257270 ACGACACAGTCAGCTTCAAAC pLKO_005 2499 3UTR 100% 10.800 5.400 Y Gm38396 n/a
11 TRCN0000235262 AGAACGCAGTGACGTACTATG pLKO_005 103 CDS 100% 10.800 5.400 Y EG665088 n/a
12 TRCN0000235274 ATACTGGAGAGAGACCTTATG pLKO_005 1357 CDS 100% 10.800 5.400 Y Gm10771 n/a
13 TRCN0000365949 CATAAGGACACTGGATCTTTC pLKO_005 387 CDS 100% 10.800 5.400 Y Zfp97 n/a
14 TRCN0000243549 CCCAGAAGAGTCTCTACAAAG pLKO_005 172 CDS 100% 10.800 5.400 Y Gm9222 n/a
15 TRCN0000365877 GTGTCATCAAAGGTTACATAC pLKO_005 1845 3UTR 100% 10.800 5.400 Y Zfp97 n/a
16 TRCN0000096189 CCAAAGAGAAACCCTATGAAT pLKO.1 1612 CDS 100% 5.625 2.813 Y Zfp960 n/a
17 TRCN0000085184 GAGCCTTTAGACAATATGTTT pLKO.1 1060 CDS 100% 5.625 2.813 Y Zfp97 n/a
18 TRCN0000096190 CCAAGTAATACTGGAGAGAAA pLKO.1 312 CDS 100% 4.950 2.475 Y Zfp960 n/a
19 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 179 CDS 100% 4.950 2.475 Y Gm4983 n/a
20 TRCN0000096192 GCAAAGCCTTTGCATGTCTTA pLKO.1 973 CDS 100% 4.950 2.475 Y Zfp960 n/a
21 TRCN0000085183 GCAAGAAACCATCATCAGTTA pLKO.1 366 CDS 100% 4.950 2.475 Y Zfp97 n/a
22 TRCN0000085186 GCAGTAATCTTCAAATCCATA pLKO.1 1411 CDS 100% 4.950 2.475 Y Zfp97 n/a
23 TRCN0000085187 CCAGTGTATGACCATTGCTCA pLKO.1 725 CDS 100% 2.640 1.320 Y Zfp97 n/a
24 TRCN0000240252 GTGATGCTCGAAACCTATAAG pLKO_005 195 CDS 100% 13.200 6.600 Y EG665101 n/a
25 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1025 CDS 100% 13.200 6.600 Y Zfp977 n/a
26 TRCN0000235263 TGTGATGCTCGAAACCTATAA pLKO_005 194 CDS 100% 13.200 6.600 Y EG665088 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005358.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.