Transcript: Human NM_001005479.2

Homo sapiens olfactory receptor family 5 subfamily H member 6 (gene/pseudogene) (OR5H6), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
OR5H6 (79295)
Length:
1113
CDS:
90..1019

Additional Resources:

NCBI RefSeq record:
NM_001005479.2
NBCI Gene record:
OR5H6 (79295)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001005479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000583844 TTCCCTTGTAACCACTGTAAC pLKO_005 395 CDS 100% 10.800 15.120 N OR5H6 n/a
2 TRCN0000583847 CTGTACTGATTCCTCTATTAA pLKO_005 653 CDS 100% 15.000 10.500 N OR5H6 n/a
3 TRCN0000185320 GAACTATGCATTCAGCTATTA pLKO.1 504 CDS 100% 13.200 9.240 N OR5H6 n/a
4 TRCN0000583902 TATCCTCTTTACAATCTTAGA pLKO_005 749 CDS 100% 4.950 3.465 N OR5H6 n/a
5 TRCN0000184846 CCTTCTGTAATTCCAACATAA pLKO.1 589 CDS 100% 13.200 7.920 N OR5H6 n/a
6 TRCN0000186944 CCTTCATATCCCAATGTACTT pLKO.1 251 CDS 100% 4.950 2.475 Y OR5H15 n/a
7 TRCN0000194282 GCAACATTGCTGACAGAGTTT pLKO.1 105 CDS 100% 4.950 2.475 Y OR5H6 n/a
8 TRCN0000202803 CTTCTTAGCTAAGAGTAAGAT pLKO.1 341 CDS 100% 0.563 0.281 Y OR5H15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001005479.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04071 pDONR223 100% 95% 95% None 0_1ins48 n/a
2 ccsbBroad304_04071 pLX_304 0% 95% 95% V5 0_1ins48 n/a
3 TRCN0000491994 ACTGGCCGACTTCGTAACCGTTCA pLX_317 41.3% 95% 95% V5 0_1ins48 n/a
Download CSV