Transcript: Human NM_001006.5

Homo sapiens ribosomal protein S3A (RPS3A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPS3A (6189)
Length:
869
CDS:
26..820

Additional Resources:

NCBI RefSeq record:
NM_001006.5
NBCI Gene record:
RPS3A (6189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074712 GCACCTGCTATGTTCAATATA pLKO.1 128 CDS 100% 15.000 10.500 N RPS3A n/a
2 TRCN0000289168 GCACCTGCTATGTTCAATATA pLKO_005 128 CDS 100% 15.000 10.500 N RPS3A n/a
3 TRCN0000117560 GAAAGATTGGTATGATGTGAA pLKO.1 106 CDS 100% 4.950 3.465 N RPS3AP21 n/a
4 TRCN0000074708 GCCAAGAAGAAAGTGGTTGAT pLKO.1 74 CDS 100% 4.950 3.465 N RPS3A n/a
5 TRCN0000289166 GCCAAGAAGAAAGTGGTTGAT pLKO_005 74 CDS 100% 4.950 3.465 N RPS3A n/a
6 TRCN0000074711 GCCCAAGTTTGAATTGGGAAA pLKO.1 685 CDS 100% 0.405 0.284 N RPS3A n/a
7 TRCN0000289165 GCCCAAGTTTGAATTGGGAAA pLKO_005 685 CDS 100% 0.405 0.284 N RPS3A n/a
8 TRCN0000074709 CCGGAAGAAGATGATGGAAAT pLKO.1 517 CDS 100% 10.800 6.480 N RPS3A n/a
9 TRCN0000289167 CCGGAAGAAGATGATGGAAAT pLKO_005 517 CDS 100% 10.800 6.480 N RPS3A n/a
10 TRCN0000117561 TCTGATGGTCTCAAGGGTCAT pLKO.1 200 CDS 100% 4.050 2.430 N RPS3AP21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01446 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01446 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479730 GCTGACGAATGTTAATAATTAATC pLX_317 54.1% 100% 100% V5 n/a
Download CSV