Transcript: Human NM_001006605.5

Homo sapiens divergent protein kinase domain 1A (DIPK1A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
DIPK1A (388650)
Length:
2536
CDS:
34..1320

Additional Resources:

NCBI RefSeq record:
NM_001006605.5
NBCI Gene record:
DIPK1A (388650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006605.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135590 GCTAAGGAAACCCTATTACCT pLKO.1 63 CDS 100% 3.000 4.200 N DIPK1A n/a
2 TRCN0000136397 CTTCTCATATGTGCGGATGAA pLKO.1 93 CDS 100% 0.000 0.000 N DIPK1A n/a
3 TRCN0000134992 CAAGTACAAGACTGGAGTTAT pLKO.1 228 CDS 100% 13.200 9.240 N DIPK1A n/a
4 TRCN0000135147 CAGAGGAAAGGACTGTAAGAA pLKO.1 195 CDS 100% 5.625 3.938 N DIPK1A n/a
5 TRCN0000135148 CAAATGGAACAAGCGCTTCAT pLKO.1 376 CDS 100% 4.950 3.465 N DIPK1A n/a
6 TRCN0000136871 CCTGCATGTAACAGCCTTTGT pLKO.1 256 CDS 100% 4.950 3.465 N DIPK1A n/a
7 TRCN0000134529 GAACTGAATTGGAACCAAGAA pLKO.1 407 CDS 100% 4.950 3.465 N DIPK1A n/a
8 TRCN0000135407 GCATGTAACAGCCTTTGTGTT pLKO.1 259 CDS 100% 4.950 3.465 N DIPK1A n/a
9 TRCN0000135502 GACAAGTACAAGACTGGAGTT pLKO.1 226 CDS 100% 4.050 2.835 N DIPK1A n/a
10 TRCN0000134431 GTGCTATTTGATAAGCCAACT pLKO.1 436 CDS 100% 4.050 2.835 N DIPK1A n/a
11 TRCN0000134388 GCTGGATTATATATGTGCAGT pLKO.1 152 CDS 100% 2.640 1.848 N DIPK1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006605.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13648 pDONR223 100% 37.6% 37.3% None (many diffs) n/a
2 ccsbBroad304_13648 pLX_304 0% 37.6% 37.3% V5 (many diffs) n/a
3 TRCN0000474247 TGACACCCGTCGTTGATCTCTCTA pLX_317 85.7% 37.6% 37.3% V5 (many diffs) n/a
Download CSV