Transcript: Human NM_001006635.3

Homo sapiens metaxin 2 (MTX2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-01
Taxon:
Homo sapiens (human)
Gene:
MTX2 (10651)
Length:
1545
CDS:
423..1184

Additional Resources:

NCBI RefSeq record:
NM_001006635.3
NBCI Gene record:
MTX2 (10651)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001006635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059750 CAAACGTAAGATGAAAGCTAT pLKO.1 887 CDS 100% 4.950 6.930 N MTX2 n/a
2 TRCN0000059749 CAAAGTAGTTTGTAGGGCAAA pLKO.1 557 CDS 100% 4.050 3.240 N MTX2 n/a
3 TRCN0000230017 ACTGGTATTTGGCCATCTATA pLKO_005 1031 CDS 100% 13.200 9.240 N MTX2 n/a
4 TRCN0000230018 TGTTAGTCTCAGGAGTCTTAA pLKO_005 1192 3UTR 100% 13.200 9.240 N MTX2 n/a
5 TRCN0000218690 TGTGGGAAATCAAGTAGTATC pLKO_005 620 CDS 100% 10.800 7.560 N MTX2 n/a
6 TRCN0000059748 GCCATCTATACACCATTCTTA pLKO.1 1042 CDS 100% 5.625 3.938 N MTX2 n/a
7 TRCN0000059752 CATGTGGGAAATCAAGTAGTA pLKO.1 618 CDS 100% 4.950 3.465 N MTX2 n/a
8 TRCN0000230015 TAGGGCAAATGCAGAATATAT pLKO_005 569 CDS 100% 15.000 9.000 N MTX2 n/a
9 TRCN0000230016 GACTGGGAACACAACCGTATT pLKO_005 979 CDS 100% 10.800 6.480 N MTX2 n/a
10 TRCN0000059751 AGGAGAATTGAACAGCACTAT pLKO.1 1131 CDS 100% 4.950 2.970 N MTX2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001006635.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02496 pDONR223 100% 95.9% 95% None 5A>C;7A>C;8_9ins30 n/a
2 ccsbBroad304_02496 pLX_304 0% 95.9% 95% V5 5A>C;7A>C;8_9ins30 n/a
3 TRCN0000481272 GGACACCCATTCTAAATTTGTTTT pLX_317 42.3% 95.9% 95% V5 5A>C;7A>C;8_9ins30 n/a
Download CSV