Transcript: Human NM_001007099.3

Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
SCP2 (6342)
Length:
1510
CDS:
85..516

Additional Resources:

NCBI RefSeq record:
NM_001007099.3
NBCI Gene record:
SCP2 (6342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007099.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147400 GTCTCGCTATGAAGTTACAAA pLKO.1 461 CDS 100% 5.625 7.875 N SCP2 n/a
2 TRCN0000343448 GTCTCGCTATGAAGTTACAAA pLKO_005 461 CDS 100% 5.625 7.875 N SCP2 n/a
3 TRCN0000149861 GCTCTGCAAGTGATGGATTTA pLKO.1 146 CDS 100% 13.200 10.560 N SCP2 n/a
4 TRCN0000148447 CCTGGCTTTAATGACTGGTAA pLKO.1 384 CDS 100% 4.950 3.465 N SCP2 n/a
5 TRCN0000343447 CCTGGCTTTAATGACTGGTAA pLKO_005 384 CDS 100% 4.950 3.465 N SCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007099.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06916 pDONR223 100% 99.7% 99.3% None 422C>G n/a
2 ccsbBroad304_06916 pLX_304 0% 99.7% 99.3% V5 (not translated due to frame shift) 422C>G n/a
Download CSV