Transcript: Human NM_001007169.5

Homo sapiens zinc finger protein 483 (ZNF483), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF483 (158399)
Length:
2686
CDS:
213..983

Additional Resources:

NCBI RefSeq record:
NM_001007169.5
NBCI Gene record:
ZNF483 (158399)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007169.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017493 CCAGCTAAAGTGGGTTGAATT pLKO.1 872 CDS 100% 0.000 0.000 N ZNF483 n/a
2 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 2151 3UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007169.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13305 pDONR223 100% 94.7% 94.5% None (many diffs) n/a
2 TRCN0000471195 ACTAATGTCAGATACCACCTCCTC pLX_317 33.5% 94.7% 94.5% V5 (many diffs) n/a
Download CSV