Transcript: Human NM_001007250.2

Homo sapiens sterol carrier protein 2 (SCP2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
SCP2 (6342)
Length:
1298
CDS:
84..263

Additional Resources:

NCBI RefSeq record:
NM_001007250.2
NBCI Gene record:
SCP2 (6342)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147400 GTCTCGCTATGAAGTTACAAA pLKO.1 330 3UTR 100% 5.625 7.875 N SCP2 n/a
2 TRCN0000343448 GTCTCGCTATGAAGTTACAAA pLKO_005 330 3UTR 100% 5.625 7.875 N SCP2 n/a
3 TRCN0000149861 GCTCTGCAAGTGATGGATTTA pLKO.1 145 CDS 100% 13.200 10.560 N SCP2 n/a
4 TRCN0000148447 CCTGGCTTTAATGACTGGTAA pLKO.1 253 CDS 100% 4.950 3.465 N SCP2 n/a
5 TRCN0000343447 CCTGGCTTTAATGACTGGTAA pLKO_005 253 CDS 100% 4.950 3.465 N SCP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06916 pDONR223 100% 41.2% 29% None 124_125ins130;177_178ins122 n/a
2 ccsbBroad304_06916 pLX_304 0% 41.2% 29% V5 (not translated due to frame shift) 124_125ins130;177_178ins122 n/a
Download CSV