Transcript: Human NM_001007527.2

Homo sapiens LMBR1 domain containing 2 (LMBRD2), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
LMBRD2 (92255)
Length:
8116
CDS:
390..2477

Additional Resources:

NCBI RefSeq record:
NM_001007527.2
NBCI Gene record:
LMBRD2 (92255)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001007527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137152 GTTGTTTGAATCTGCTCGGTT pLKO.1 2041 CDS 100% 2.640 3.696 N LMBRD2 n/a
2 TRCN0000418353 TCTCTGCATTGCTACTTATTT pLKO_005 2006 CDS 100% 15.000 10.500 N LMBRD2 n/a
3 TRCN0000434715 GTGTTCAGGATTCGTGTATTT pLKO_005 1743 CDS 100% 13.200 9.240 N LMBRD2 n/a
4 TRCN0000135213 CAAGGCTTACTTACTAGACAT pLKO.1 2982 3UTR 100% 4.950 3.465 N LMBRD2 n/a
5 TRCN0000137128 CGGATAGAACTTCTCCAAGAT pLKO.1 2331 CDS 100% 4.950 3.465 N LMBRD2 n/a
6 TRCN0000136187 GCAGTTCAGTTTGTTTCAGAT pLKO.1 2763 3UTR 100% 4.950 3.465 N LMBRD2 n/a
7 TRCN0000135559 GTCTTGATGAACATCTGTGTA pLKO.1 2528 3UTR 100% 4.950 3.465 N LMBRD2 n/a
8 TRCN0000135408 GTACCCTAGAATTTCCTCTAT pLKO.1 2546 3UTR 100% 0.000 0.000 N LMBRD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001007527.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09332 pDONR223 100% 99.9% 100% None 927G>T n/a
2 ccsbBroad304_09332 pLX_304 0% 99.9% 100% V5 927G>T n/a
3 TRCN0000470126 TGCTAGGGAATCCTAGGAAAAACG pLX_317 18.5% 99.9% 100% V5 927G>T n/a
Download CSV