Transcript: Human NM_001008409.4

Homo sapiens tubulin tyrosine ligase like 9 (TTLL9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TTLL9 (164395)
Length:
3579
CDS:
322..1641

Additional Resources:

NCBI RefSeq record:
NM_001008409.4
NBCI Gene record:
TTLL9 (164395)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008409.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180032 CCCTTGCTTTCCTCACTTGAT pLKO.1 3161 3UTR 100% 4.950 3.465 N TTLL9 n/a
2 TRCN0000149608 GAAGGTGATCATCAGTGACAA pLKO.1 1251 CDS 100% 4.950 3.465 N TTLL9 n/a
3 TRCN0000148520 CCATGGATTGTCAAAGGGAAA pLKO.1 408 CDS 100% 4.050 2.835 N TTLL9 n/a
4 TRCN0000146960 CCCAAGAAATTACAGAACCAA pLKO.1 376 CDS 100% 3.000 2.100 N TTLL9 n/a
5 TRCN0000147563 GCCTGTGTTTCTATGTAACTA pLKO.1 3370 3UTR 100% 5.625 3.375 N TTLL9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008409.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13339 pDONR223 100% 46.1% 39.4% None (many diffs) n/a
2 ccsbBroad304_13339 pLX_304 0% 46.1% 39.4% V5 (many diffs) n/a
3 TRCN0000472304 ATGATCTGCCCAAGATAGAGCTCG pLX_317 70.4% 46.1% 39.4% V5 (many diffs) n/a
Download CSV