Transcript: Human NM_001008938.4

Homo sapiens cytoskeleton associated protein 5 (CKAP5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CKAP5 (9793)
Length:
7172
CDS:
99..6197

Additional Resources:

NCBI RefSeq record:
NM_001008938.4
NBCI Gene record:
CKAP5 (9793)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001008938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113888 GCTGGCGATTATGCAGATTTA pLKO.1 1038 CDS 100% 13.200 18.480 N CKAP5 n/a
2 TRCN0000290837 GCTGGCGATTATGCAGATTTA pLKO_005 1038 CDS 100% 13.200 18.480 N CKAP5 n/a
3 TRCN0000113886 CCTGCAGCTTTAGTTTACTAA pLKO.1 6220 3UTR 100% 5.625 3.938 N CKAP5 n/a
4 TRCN0000290907 CCTGCAGCTTTAGTTTACTAA pLKO_005 6220 3UTR 100% 5.625 3.938 N CKAP5 n/a
5 TRCN0000113889 GCTAACATAGACGACTTGAAA pLKO.1 6141 CDS 100% 5.625 3.938 N CKAP5 n/a
6 TRCN0000290906 GCTAACATAGACGACTTGAAA pLKO_005 6141 CDS 100% 5.625 3.938 N CKAP5 n/a
7 TRCN0000113890 CCAGAGGAATTTCCAAGCATA pLKO.1 2560 CDS 100% 4.950 2.970 N CKAP5 n/a
8 TRCN0000290836 CCAGAGGAATTTCCAAGCATA pLKO_005 2560 CDS 100% 4.950 2.970 N CKAP5 n/a
9 TRCN0000113887 GCACAGAACATAAGCTCCAAT pLKO.1 4422 CDS 100% 4.950 2.970 N CKAP5 n/a
10 TRCN0000290908 GCACAGAACATAAGCTCCAAT pLKO_005 4422 CDS 100% 4.950 2.970 N CKAP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001008938.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11416 pDONR223 100% 46.8% 46.8% None 1_3237del;4297A>G n/a
2 TRCN0000473345 ATCGGGTATTTAAACGTAAGCCGA pLX_317 17% 46.8% 46.8% V5 1_3237del;4297A>G n/a
Download CSV