Transcript: Human NM_001009.4

Homo sapiens ribosomal protein S5 (RPS5), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPS5 (6193)
Length:
741
CDS:
73..687

Additional Resources:

NCBI RefSeq record:
NM_001009.4
NBCI Gene record:
RPS5 (6193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074755 CGGAACATTAAGACCATTGCT pLKO.1 562 CDS 100% 3.000 4.200 N RPS5 n/a
2 TRCN0000344828 AGCATGCCTTCGAGATCATAC pLKO_005 353 CDS 100% 10.800 8.640 N RPS5 n/a
3 TRCN0000369934 GCAAAGCTCAGTGTCCCATTG pLKO_005 257 CDS 100% 6.000 4.200 N RPS5 n/a
4 TRCN0000074754 ACCGATGATGTGCAGATCAAT pLKO.1 145 CDS 100% 5.625 3.938 N RPS5 n/a
5 TRCN0000333509 ACCGATGATGTGCAGATCAAT pLKO_005 145 CDS 100% 5.625 3.938 N RPS5 n/a
6 TRCN0000074756 CCTCACTAACTCCATGATGAT pLKO.1 285 CDS 100% 4.950 3.465 N RPS5 n/a
7 TRCN0000074753 GCAGGATTACATTGCAGTGAA pLKO.1 177 CDS 100% 4.950 3.465 N RPS5 n/a
8 TRCN0000074757 GCGCCTCACTAACTCCATGAT pLKO.1 282 CDS 100% 4.950 3.465 N RPS5 n/a
9 TRCN0000333448 GCGCCTCACTAACTCCATGAT pLKO_005 282 CDS 100% 4.950 3.465 N RPS5 n/a
10 TRCN0000369936 ACAACGGCAAGAAGCTCATGA pLKO_005 317 CDS 100% 4.950 2.970 N RPS5 n/a
11 TRCN0000369867 TCCTGGTGAACGCCATCATCA pLKO_005 404 CDS 100% 4.950 2.475 Y RPS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.