Transcript: Human NM_001009609.4

Homo sapiens SPANX family member N3 (SPANXN3), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SPANXN3 (139067)
Length:
590
CDS:
85..510

Additional Resources:

NCBI RefSeq record:
NM_001009609.4
NBCI Gene record:
SPANXN3 (139067)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009609.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245762 TACCTCAGGAAGGGTAAGAAA pLKO_005 250 CDS 100% 0.000 0.000 N SPANXN3 n/a
2 TRCN0000167517 GATGGCGATGATTACAATAAA pLKO.1 551 3UTR 100% 15.000 10.500 N SPANXN3 n/a
3 TRCN0000257457 AGGACGAAGGCGTAGACTTAT pLKO_005 338 CDS 100% 13.200 9.240 N SPANXN3 n/a
4 TRCN0000245763 GAATGAACAGTCCCAAGAGAA pLKO_005 291 CDS 100% 4.950 3.465 N SPANXN3 n/a
5 TRCN0000245764 GATGAAGACCTAGGCCCATGT pLKO_005 379 CDS 100% 4.050 2.835 N SPANXN3 n/a
6 TRCN0000245761 GACCTTCAAAGGAGGACAAAG pLKO_005 404 CDS 100% 10.800 6.480 N SPANXN3 n/a
7 TRCN0000172859 GAGGATGAAGACCTAGGCTTA pLKO.1 454 CDS 100% 4.050 2.430 N SPANXN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009609.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09577 pDONR223 100% 99.5% 99.2% None 21C>T;129C>G n/a
2 ccsbBroad304_09577 pLX_304 0% 99.5% 99.2% V5 21C>T;129C>G n/a
3 TRCN0000476506 CGCCTACTTGTCCCTATCCATCTA pLX_317 69.7% 99.5% 99.2% V5 21C>T;129C>G n/a
Download CSV