Transcript: Human NM_001009991.3

Homo sapiens synaptotagmin like 3 (SYTL3), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-25
Taxon:
Homo sapiens (human)
Gene:
SYTL3 (94120)
Length:
2284
CDS:
384..2012

Additional Resources:

NCBI RefSeq record:
NM_001009991.3
NBCI Gene record:
SYTL3 (94120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001009991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437661 AGGTCAGTGCACCAGATATTC pLKO_005 901 CDS 100% 13.200 18.480 N SYTL3 n/a
2 TRCN0000179386 GAGAAATACGAAGACAGCGTT pLKO.1 1491 CDS 100% 2.640 3.696 N SYTL3 n/a
3 TRCN0000433067 ATCACTTCATGGTCAACTTTG pLKO_005 1607 CDS 100% 10.800 8.640 N SYTL3 n/a
4 TRCN0000147564 GCACCTTGAACTCATTTGTTA pLKO.1 1672 CDS 100% 5.625 3.938 N SYTL3 n/a
5 TRCN0000150165 CAAATGCTCTACTAACCCTAT pLKO.1 947 CDS 100% 4.050 2.835 N SYTL3 n/a
6 TRCN0000181018 CGGAGAGTGTTTCTTGGAGAA pLKO.1 1389 CDS 100% 4.050 2.835 N SYTL3 n/a
7 TRCN0000422165 GTGCTAGGAGCCAAGAATTTA pLKO_005 1635 CDS 100% 15.000 9.000 N SYTL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001009991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13004 pDONR223 100% 88.7% 88.6% None 512_513ins204;1440A>G;1556T>A n/a
2 ccsbBroad304_13004 pLX_304 0% 88.7% 88.6% V5 512_513ins204;1440A>G;1556T>A n/a
3 TRCN0000468926 GAGGACAAGAGTTATGCAACAACC pLX_317 23.9% 88.7% 88.6% V5 512_513ins204;1440A>G;1556T>A n/a
Download CSV