Transcript: Human NM_001010000.3

Homo sapiens Rho GTPase activating protein 28 (ARHGAP28), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ARHGAP28 (79822)
Length:
5482
CDS:
208..1920

Additional Resources:

NCBI RefSeq record:
NM_001010000.3
NBCI Gene record:
ARHGAP28 (79822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144667 GCCATTCAACTCAACAATCAA pLKO.1 1696 CDS 100% 5.625 7.875 N ARHGAP28 n/a
2 TRCN0000141350 CAGCCAGTTCAGAATGCGATA pLKO.1 517 CDS 100% 4.050 5.670 N ARHGAP28 n/a
3 TRCN0000142196 GAAATGGTTACGGAGGCTCTA pLKO.1 610 CDS 100% 4.050 5.670 N ARHGAP28 n/a
4 TRCN0000142766 CCAGTTCAGAATGCGATAAGT pLKO.1 520 CDS 100% 5.625 4.500 N ARHGAP28 n/a
5 TRCN0000142517 GCCTCACGTCAAAGTACAGTT pLKO.1 1188 CDS 100% 4.950 3.465 N ARHGAP28 n/a
6 TRCN0000122069 CAACTCAACAATCAAACCAAA pLKO.1 1702 CDS 100% 4.950 2.970 N ARHGAP28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010000.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12624 pDONR223 100% 68.2% 68.2% None (many diffs) n/a
2 ccsbBroad304_12624 pLX_304 0% 68.2% 68.2% V5 (many diffs) n/a
3 TRCN0000467709 ATCTACCTATCTCATTCGATGCCG pLX_317 36.3% 68.2% 68.2% V5 (many diffs) n/a
Download CSV