Transcript: Human NM_001010888.3

Homo sapiens zinc finger CCCH-type containing 12B (ZC3H12B), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
ZC3H12B (340554)
Length:
7273
CDS:
68..2578

Additional Resources:

NCBI RefSeq record:
NM_001010888.3
NBCI Gene record:
ZC3H12B (340554)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242231 GCATGCATAACCGAGAGTATT pLKO_005 1743 CDS 100% 13.200 18.480 N ZC3H12B n/a
2 TRCN0000242227 TGCCTAGATCGTCCAAGTTTC pLKO_005 320 CDS 100% 10.800 15.120 N ZC3H12B n/a
3 TRCN0000242229 ATGACCGGTTCATAGTCAAAC pLKO_005 906 CDS 100% 10.800 8.640 N ZC3H12B n/a
4 TRCN0000168033 CAATGATTCCAGGGAGCATAT pLKO.1 2407 CDS 100% 10.800 8.640 N ZC3H12B n/a
5 TRCN0000242230 TGTCCACCCTTTGGGTAATAA pLKO_005 4159 3UTR 100% 15.000 10.500 N ZC3H12B n/a
6 TRCN0000242228 CTTAGGGCTGCACGTTGATAT pLKO_005 2561 CDS 100% 13.200 9.240 N ZC3H12B n/a
7 TRCN0000172337 CCACTCCTATCCCTTGAGTAA pLKO.1 2293 CDS 100% 4.950 3.465 N ZC3H12B n/a
8 TRCN0000172544 GCAACCATGTCCTTATGGCAA pLKO.1 1141 CDS 100% 2.640 1.848 N ZC3H12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010888.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13601 pDONR223 100% 98.6% 98.6% None 1_33del n/a
2 ccsbBroad304_13601 pLX_304 0% 98.6% 98.6% V5 1_33del n/a
3 TRCN0000480515 TCATACAATACATATTCGGTTACG pLX_317 14.4% 98.6% 98.6% V5 1_33del n/a
Download CSV