Transcript: Human NM_001011552.4

Homo sapiens solute carrier family 9 member A4 (SLC9A4), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC9A4 (389015)
Length:
4215
CDS:
535..2931

Additional Resources:

NCBI RefSeq record:
NM_001011552.4
NBCI Gene record:
SLC9A4 (389015)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183849 CCCTCCAAACTGAAACTAATT pLKO.1 3411 3UTR 100% 13.200 18.480 N SLC9A4 n/a
2 TRCN0000148278 CGTCTTCATGTTCAGCTATTT pLKO.1 1449 CDS 100% 13.200 18.480 N SLC9A4 n/a
3 TRCN0000438387 TGGAGAGCCATCAGCGTATTT pLKO_005 1720 CDS 100% 13.200 18.480 N SLC9A4 n/a
4 TRCN0000146603 CTGGATTATGACTATGTGCAA pLKO.1 718 CDS 100% 2.640 3.696 N SLC9A4 n/a
5 TRCN0000434379 TTCGTCTGATGGATCACTTAA pLKO_005 2018 CDS 100% 13.200 10.560 N SLC9A4 n/a
6 TRCN0000147774 GAAAGAACCTACCCAAATCAA pLKO.1 2138 CDS 100% 5.625 4.500 N SLC9A4 n/a
7 TRCN0000068141 CCAGACATCATACACGACCAT pLKO.1 1566 CDS 100% 2.640 2.112 N Slc9a4 n/a
8 TRCN0000426151 TGAAATACAAGCGTGATTAAT pLKO_005 3242 3UTR 100% 15.000 10.500 N SLC9A4 n/a
9 TRCN0000418817 AGTTTGATCATAGATACTTAC pLKO_005 2102 CDS 100% 10.800 7.560 N SLC9A4 n/a
10 TRCN0000419660 GTAATTCACATTGCCGATATG pLKO_005 3265 3UTR 100% 10.800 7.560 N SLC9A4 n/a
11 TRCN0000146261 CAGAGGATACAAGGAATCAAA pLKO.1 2260 CDS 100% 5.625 3.938 N SLC9A4 n/a
12 TRCN0000178801 CATCAGCGTATTTGCTCTCTT pLKO.1 1728 CDS 100% 4.950 3.465 N SLC9A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011552.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.