Transcript: Mouse NM_001012324.2

Mus musculus extracellular matrix protein 2, female organ and adipocyte specific (Ecm2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ecm2 (407800)
Length:
3626
CDS:
226..2238

Additional Resources:

NCBI RefSeq record:
NM_001012324.2
NBCI Gene record:
Ecm2 (407800)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001012324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184023 CGGCACCTTCTGCCATTTATA pLKO.1 2417 3UTR 100% 15.000 21.000 N Ecm2 n/a
2 TRCN0000183218 GAATCGCTTCTAAGTAATCTT pLKO.1 451 CDS 100% 5.625 7.875 N Ecm2 n/a
3 TRCN0000216513 GTACTTGTACCTGTCATTTAA pLKO.1 1890 CDS 100% 15.000 10.500 N Ecm2 n/a
4 TRCN0000254204 TGTCTATGATCTAGCTATTAA pLKO_005 3314 3UTR 100% 15.000 10.500 N Ecm2 n/a
5 TRCN0000254202 CAACAATAAGATTCGGAATAT pLKO_005 2055 CDS 100% 13.200 9.240 N Ecm2 n/a
6 TRCN0000254203 TCTATTGACCTGTCCTATAAC pLKO_005 1753 CDS 100% 13.200 9.240 N Ecm2 n/a
7 TRCN0000254205 TGCTGAACAAGAATCCATTAA pLKO_005 687 CDS 100% 13.200 9.240 N Ecm2 n/a
8 TRCN0000150882 GCATATCATTCTCTGAGAGAA pLKO.1 1954 CDS 100% 4.950 3.465 N ECM2 n/a
9 TRCN0000254206 AGAATGTCCTCCCGGGTAATT pLKO_005 1036 CDS 100% 13.200 7.920 N Ecm2 n/a
10 TRCN0000145217 GAAGAAGAAGAAGAGGATGAT pLKO.1 997 CDS 100% 4.950 2.475 Y PTMS n/a
11 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 991 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.