Transcript: Mouse NM_001012520.2

Mus musculus killer cell lectin-like receptor family I member 1 (Klri1), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Klri1 (503550)
Length:
838
CDS:
11..757

Additional Resources:

NCBI RefSeq record:
NM_001012520.2
NBCI Gene record:
Klri1 (503550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001012520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347413 ATACAGAACACCCTAACTAAT pLKO_005 632 CDS 100% 13.200 18.480 N Klri1 n/a
2 TRCN0000347414 ACAGAGTTGAAGACATGTAAG pLKO_005 65 CDS 100% 10.800 7.560 N Klri1 n/a
3 TRCN0000173480 GCTATGTGAAGAGCAGCTAAA pLKO.1 133 CDS 100% 10.800 7.560 N Klri1 n/a
4 TRCN0000254874 GCTATGTGAAGAGCAGCTAAA pLKO_005 133 CDS 100% 10.800 7.560 N Klri1 n/a
5 TRCN0000347449 TGACAACCACAGGGATCTTAC pLKO_005 291 CDS 100% 10.800 7.560 N Klri1 n/a
6 TRCN0000254799 TGACGCCTCCTGTGATCTTTG pLKO_005 385 CDS 100% 10.800 7.560 N Klri1 n/a
7 TRCN0000452375 AGAATCATAGCTGCCATTATC pLKO_005 666 CDS 100% 13.200 6.600 Y Klri2 n/a
8 TRCN0000193975 GAAGAATCATAGCTGCCATTA pLKO.1 664 CDS 100% 10.800 5.400 Y Klri1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012520.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.