Transcript: Human NM_001012662.3

Homo sapiens solute carrier family 3 member 2 (SLC3A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
SLC3A2 (6520)
Length:
2224
CDS:
162..2057

Additional Resources:

NCBI RefSeq record:
NM_001012662.3
NBCI Gene record:
SLC3A2 (6520)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435809 AGTCTCTTGCAATCGGCTAAA pLKO_005 1038 CDS 100% 10.800 15.120 N SLC3A2 n/a
2 TRCN0000431983 GCCTACTCGAATCCAACAAAG pLKO_005 1333 CDS 100% 10.800 15.120 N SLC3A2 n/a
3 TRCN0000043386 GCTGGGTCCAATTCACAAGAA pLKO.1 944 CDS 100% 4.950 6.930 N SLC3A2 n/a
4 TRCN0000043384 CGAGAAGAATGGTCTGGTGAA pLKO.1 578 CDS 100% 4.050 3.240 N SLC3A2 n/a
5 TRCN0000043383 GCCTGGACTCTTCTCCTATAT pLKO.1 1805 CDS 100% 13.200 9.240 N SLC3A2 n/a
6 TRCN0000430528 TTGCTGGTGCCGTGGTCATAA pLKO_005 754 CDS 100% 13.200 9.240 N SLC3A2 n/a
7 TRCN0000043387 CTAGCTCATACCTGTCTGATT pLKO.1 1366 CDS 100% 4.950 3.465 N SLC3A2 n/a
8 TRCN0000043385 TCCGTGTCATTCTGGACCTTA pLKO.1 1069 CDS 100% 4.950 3.465 N SLC3A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012662.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01545 pDONR223 100% 83.8% 83.8% None 1_306del n/a
2 ccsbBroad304_01545 pLX_304 0% 83.8% 83.8% V5 1_306del n/a
3 TRCN0000478190 TTGTTCTTCGAGCGACAGAAAGGG pLX_317 16.7% 83.8% 83.8% V5 1_306del n/a
Download CSV