Transcript: Human NM_001012754.4

Homo sapiens NHL repeat containing 3 (NHLRC3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
NHLRC3 (387921)
Length:
3411
CDS:
185..1228

Additional Resources:

NCBI RefSeq record:
NM_001012754.4
NBCI Gene record:
NHLRC3 (387921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012754.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161732 CGAGCCTGGAATTATACAGTT pLKO.1 476 CDS 100% 4.950 6.930 N NHLRC3 n/a
2 TRCN0000159385 GCCCTTCTAAATGTGCTATTT pLKO.1 2843 3UTR 100% 13.200 9.240 N NHLRC3 n/a
3 TRCN0000165385 CCGTGAGGTTAGGAAGGTAAA pLKO.1 2594 3UTR 100% 10.800 7.560 N NHLRC3 n/a
4 TRCN0000161257 GCTGGCTTCTTTCTTGCATTT pLKO.1 215 CDS 100% 10.800 7.560 N NHLRC3 n/a
5 TRCN0000160403 CCCAAGATTTCATGATCCTTT pLKO.1 765 CDS 100% 4.950 3.465 N NHLRC3 n/a
6 TRCN0000160716 CCTCACAGTGTTACACTTGAT pLKO.1 830 CDS 100% 4.950 3.465 N NHLRC3 n/a
7 TRCN0000159023 GAAGTGGATTCTTTGGTCATA pLKO.1 564 CDS 100% 4.950 3.465 N NHLRC3 n/a
8 TRCN0000162210 CAGTTTGATAACCCAGCAGAA pLKO.1 668 CDS 100% 4.050 2.835 N NHLRC3 n/a
9 TRCN0000159870 GCTATGTTCCTTCATTTGGTT pLKO.1 1203 CDS 100% 3.000 2.100 N NHLRC3 n/a
10 TRCN0000158724 GCAGTCTATGTAGCAGAAATT pLKO.1 1145 CDS 100% 13.200 7.920 N NHLRC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012754.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05570 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05570 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475560 AACTCATTCCTTGCGATGAATGGC pLX_317 19.3% 100% 100% V5 n/a
Download CSV