Transcript: Human NM_001013355.1

Homo sapiens olfactory receptor family 2 subfamily G member 6 (OR2G6), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
OR2G6 (391211)
Length:
951
CDS:
1..951

Additional Resources:

NCBI RefSeq record:
NM_001013355.1
NBCI Gene record:
OR2G6 (391211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000189422 CCTCATCACCTCCCTAATTCA pLKO.1 456 CDS 100% 5.625 7.875 N OR2G6 n/a
2 TRCN0000187267 CATCGCACACTGGATCATATT pLKO.1 511 CDS 100% 13.200 10.560 N OR2G6 n/a
3 TRCN0000584899 TTGGGCTCGTCTGAGTGTATT pLKO_005 319 CDS 100% 13.200 9.240 N OR2G6 n/a
4 TRCN0000202547 CTGGTTACCATGAATAAGAAA pLKO.1 244 CDS 100% 5.625 3.938 N OR2G6 n/a
5 TRCN0000187390 CCACACTCCAATGTACTTCTT pLKO.1 165 CDS 100% 4.950 2.970 N Olfr853 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013355.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10110 pDONR223 100% 99.8% 100% None 306T>C n/a
2 ccsbBroad304_10110 pLX_304 0% 99.8% 100% V5 306T>C n/a
3 TRCN0000480822 CGGGACAACGTCGAAACGCATTTG pLX_317 47% 99.8% 100% V5 306T>C n/a
Download CSV