Transcript: Mouse NM_001013608.2

Mus musculus excision repair cross-complementing rodent repair deficiency, complementation group 6 like 2 (Ercc6l2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Ercc6l2 (76251)
Length:
5589
CDS:
156..4769

Additional Resources:

NCBI RefSeq record:
NM_001013608.2
NBCI Gene record:
Ercc6l2 (76251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241459 ACCGTAGCTCTCAGGTTATTG pLKO_005 3220 CDS 100% 13.200 18.480 N Ercc6l2 n/a
2 TRCN0000241460 ACGTGCCATTAACCTAGATAT pLKO_005 4777 3UTR 100% 13.200 18.480 N Ercc6l2 n/a
3 TRCN0000241456 AGGATATGTGATCGGGTATTT pLKO_005 1578 CDS 100% 13.200 18.480 N Ercc6l2 n/a
4 TRCN0000241457 TAATAGGTACTTGCGAGATTA pLKO_005 509 CDS 100% 13.200 18.480 N Ercc6l2 n/a
5 TRCN0000177328 GCATGTTATCATGGGTTCTTT pLKO.1 4906 3UTR 100% 5.625 7.875 N Ercc6l2 n/a
6 TRCN0000197468 CCACTACTTCCTTGAAATTTA pLKO.1 3115 CDS 100% 15.000 12.000 N Ercc6l2 n/a
7 TRCN0000176683 CCCATTCATTATCTGAAAGAT pLKO.1 5157 3UTR 100% 5.625 4.500 N Ercc6l2 n/a
8 TRCN0000217232 CAATGAGCTGCTTCGTTTAAA pLKO.1 848 CDS 100% 15.000 10.500 N Ercc6l2 n/a
9 TRCN0000241458 CAATGAGCTGCTTCGTTTAAA pLKO_005 848 CDS 100% 15.000 10.500 N Ercc6l2 n/a
10 TRCN0000176466 CCCTCAAATGATAGTACTTTA pLKO.1 4041 CDS 100% 13.200 9.240 N Ercc6l2 n/a
11 TRCN0000217404 GAATCCCTAAGAACCATATAC pLKO.1 2860 CDS 100% 13.200 9.240 N Ercc6l2 n/a
12 TRCN0000177526 CCACTCAAATCAGAATGTGAT pLKO.1 3488 CDS 100% 4.950 3.465 N Ercc6l2 n/a
13 TRCN0000197942 GTAAAGGAGTTTGCTGAACAA pLKO.1 3840 CDS 100% 4.950 3.465 N Ercc6l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.