Transcript: Human NM_001014447.3

Homo sapiens carboxypeptidase Z (CPZ), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CPZ (8532)
Length:
2163
CDS:
70..2028

Additional Resources:

NCBI RefSeq record:
NM_001014447.3
NBCI Gene record:
CPZ (8532)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425817 TGATGGACAGGTCGGAGAATA pLKO_005 1343 CDS 100% 13.200 18.480 N CPZ n/a
2 TRCN0000073878 CGGATCTCAGTCAAAGGCATT pLKO.1 1633 CDS 100% 4.050 5.670 N CPZ n/a
3 TRCN0000222547 CGTGTGGACTTCATTCTGCAA pLKO.1 1795 CDS 100% 2.640 2.112 N CPZ n/a
4 TRCN0000073880 CCTGGATCTGAACCGAAATTT pLKO.1 1023 CDS 100% 15.000 10.500 N CPZ n/a
5 TRCN0000435376 CAAGGAGTCACTCCTGAATTT pLKO_005 1542 CDS 100% 13.200 9.240 N CPZ n/a
6 TRCN0000428744 GGATGCAGACCATACCCTTTG pLKO_005 1169 CDS 100% 6.000 4.200 N CPZ n/a
7 TRCN0000073879 CCAGGTATCCACATTGTCATT pLKO.1 1705 CDS 100% 4.950 3.465 N CPZ n/a
8 TRCN0000222548 CATCGGCAACATTCATGGCAA pLKO.1 798 CDS 100% 2.640 1.848 N CPZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014447.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07255 pDONR223 100% 78.7% 78.6% None (many diffs) n/a
2 ccsbBroad304_07255 pLX_304 0% 78.7% 78.6% V5 (many diffs) n/a
3 TRCN0000475175 CTCCAGAGTATTAAAGAACATGGG pLX_317 16.5% 78.7% 78.6% V5 (many diffs) n/a
Download CSV