Transcript: Human NM_001017.3

Homo sapiens ribosomal protein S13 (RPS13), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RPS13 (6207)
Length:
527
CDS:
27..482

Additional Resources:

NCBI RefSeq record:
NM_001017.3
NBCI Gene record:
RPS13 (6207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418135 TCCTTCACAGATCGGTGTAAT pLKO_005 164 CDS 100% 13.200 18.480 N RPS13 n/a
2 TRCN0000007171 GATGCTAAATTCCGTCTGATT pLKO.1 354 CDS 100% 4.950 6.930 N RPS13 n/a
3 TRCN0000415380 TGGTGTTGCACAAGTACGTTT pLKO_005 200 CDS 100% 4.950 6.930 N RPS13 n/a
4 TRCN0000412294 GTTGACATCTGACGACGTGAA pLKO_005 107 CDS 100% 4.050 5.670 N RPS13 n/a
5 TRCN0000007174 CCTGAAGATCTCTACCATTTA pLKO.1 279 CDS 100% 13.200 9.240 N RPS13 n/a
6 TRCN0000435453 GAAAGGATAAGGATGCTAAAT pLKO_005 343 CDS 100% 13.200 9.240 N RPS13 n/a
7 TRCN0000415132 GACGTGAAGGAGCAGATTTAC pLKO_005 120 CDS 100% 13.200 9.240 N RPS13 n/a
8 TRCN0000098518 TGAGAGGAACAGAAAGGATAA pLKO.1 332 CDS 100% 10.800 7.560 N Rps13 n/a
9 TRCN0000007173 CCACTTGGTTGAAGTTGACAT pLKO.1 94 CDS 100% 4.950 3.465 N RPS13 n/a
10 TRCN0000426153 TGCTGTTCGAAAGCATCTTGA pLKO_005 314 CDS 100% 4.950 3.465 N RPS13 n/a
11 TRCN0000098516 ACAGAAAGGATAAGGATGCTA pLKO.1 340 CDS 100% 3.000 2.100 N Rps13 n/a
12 TRCN0000007172 GCAGATTTACAAACTGGCCAA pLKO.1 131 CDS 100% 2.160 1.512 N RPS13 n/a
13 TRCN0000007170 GCTCCTGATCTTCCTGAAGAT pLKO.1 267 CDS 100% 0.495 0.347 N RPS13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01452 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01452 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478232 AGTCCCCACTGTAGGACGATGTAC pLX_317 64.2% 100% 100% V5 n/a
Download CSV