Transcript: Human NM_001017372.3

Homo sapiens solute carrier family 27 member 6 (SLC27A6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SLC27A6 (28965)
Length:
2863
CDS:
651..2510

Additional Resources:

NCBI RefSeq record:
NM_001017372.3
NBCI Gene record:
SLC27A6 (28965)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425642 CAGCTACCGAATCAAGCATAT pLKO_005 1735 CDS 100% 10.800 15.120 N SLC27A6 n/a
2 TRCN0000432445 GCTTATGCTTGTCCACGATTT pLKO_005 2301 CDS 100% 10.800 15.120 N SLC27A6 n/a
3 TRCN0000043419 GCTCATTATAATTCGGCTGAA pLKO.1 764 CDS 100% 4.050 5.670 N SLC27A6 n/a
4 TRCN0000043418 CCAGGGAACTTTATGATCAAA pLKO.1 2464 CDS 100% 5.625 4.500 N SLC27A6 n/a
5 TRCN0000043422 GTATCATAGTTCAGCAGCTAT pLKO.1 1445 CDS 100% 4.950 3.960 N SLC27A6 n/a
6 TRCN0000043421 CCTTAATACTGGAGACTTAAT pLKO.1 2027 CDS 100% 13.200 9.240 N SLC27A6 n/a
7 TRCN0000043420 CCCATGTCTTCCTGAACCATT pLKO.1 928 CDS 100% 4.950 3.465 N SLC27A6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08095 pDONR223 100% 99.7% 99.5% None (many diffs) n/a
2 ccsbBroad304_08095 pLX_304 0% 99.7% 99.5% V5 (many diffs) n/a
3 TRCN0000478845 TAGCACCCCTCGGCTAGGTAGCGC pLX_317 20.6% 99.7% 99.5% V5 (many diffs) n/a
Download CSV