Transcript: Human NM_001017396.3

Homo sapiens zinc finger protein 2 (ZNF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ZNF2 (7549)
Length:
3508
CDS:
146..1297

Additional Resources:

NCBI RefSeq record:
NM_001017396.3
NBCI Gene record:
ZNF2 (7549)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244918 GACCCTCGCTATCAGTGTAAC pLKO_005 1031 CDS 100% 10.800 15.120 N ZNF2 n/a
2 TRCN0000016209 CGTCTCTGAATAGACATCAGA pLKO.1 996 CDS 100% 0.300 0.420 N ZNF2 n/a
3 TRCN0000244915 AGTCCTCTGTGTCCTAAATTT pLKO_005 374 CDS 100% 15.000 10.500 N ZNF2 n/a
4 TRCN0000244916 TCAGCCCTGTCCAGGGAAATT pLKO_005 497 CDS 100% 13.200 9.240 N ZNF2 n/a
5 TRCN0000244919 TGATATCACAGCAGTACTATT pLKO_005 1634 3UTR 100% 13.200 9.240 N ZNF2 n/a
6 TRCN0000016210 CGTTACGCCAAACAGGGAATA pLKO.1 1271 CDS 100% 10.800 7.560 N ZNF2 n/a
7 TRCN0000244917 CTTACTCGCCATCAGCTAATC pLKO_005 917 CDS 100% 10.800 7.560 N ZNF2 n/a
8 TRCN0000016212 GTCCTTATGAATGTCATCAGT pLKO.1 867 CDS 100% 3.000 2.100 N ZNF2 n/a
9 TRCN0000016208 CCTGTCTTAAAGCTGCCATTT pLKO.1 1355 3UTR 100% 10.800 6.480 N ZNF2 n/a
10 TRCN0000016211 GCGAATTCACACTGGAGAGAA pLKO.1 763 CDS 100% 0.000 0.000 Y ZNF2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3068 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3068 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017396.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15621 pDONR223 0% 76.2% 76.2% None 1_273del n/a
2 ccsbBroad304_15621 pLX_304 0% 76.2% 76.2% V5 1_273del n/a
3 TRCN0000472119 GACCCCTTATCGGGTATCAGTCTT pLX_317 48.3% 76.1% 75.9% V5 1_273del;1136A>C n/a
4 ccsbBroadEn_11224 pDONR223 100% 76.1% 75.9% None 1_273del;979T>C n/a
5 ccsbBroad304_11224 pLX_304 0% 76.1% 75.9% V5 1_273del;979T>C n/a
6 TRCN0000472120 CAGCCAGGTCAGATCCCTGGGAGC pLX_317 42.1% 76.1% 75.9% V5 1_273del;979T>C n/a
Download CSV