Transcript: Human NM_001017529.2

Homo sapiens proline rich 5 (PRR5), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PRR5 (55615)
Length:
1726
CDS:
411..1292

Additional Resources:

NCBI RefSeq record:
NM_001017529.2
NBCI Gene record:
PRR5 (55615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047359 ACTCGGATTCTGAAGGGATTT pLKO.1 1195 CDS 100% 10.800 8.640 N PRR5 n/a
2 TRCN0000156729 GACTCGGATTCTGAAGGGATT pLKO.1 1194 CDS 100% 4.050 2.835 N PRR5 n/a
3 TRCN0000047360 CTCAGTGTGAAGCTAGAGGAT pLKO.1 597 CDS 100% 2.640 1.848 N PRR5 n/a
4 TRCN0000155182 GTTGGAAATACCATCAGCCTT pLKO.1 1447 3UTR 100% 2.640 1.848 N PRR5 n/a
5 TRCN0000184738 CTTCTTCTTCAGTGACGTGCT pLKO.1 485 CDS 100% 2.160 1.512 N PRR5 n/a
6 TRCN0000047358 CGGGACAAGATTCGCTTCTAT pLKO.1 423 CDS 100% 5.625 2.813 Y PRR5 n/a
7 TRCN0000195939 CGGGACAAGATTCGCTTCTAT pLKO.1 423 CDS 100% 5.625 2.813 Y PRR5 n/a
8 TRCN0000047362 GTGATCCTTCGGGACAAGATT pLKO.1 414 CDS 100% 5.625 2.813 Y PRR5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12235 pDONR223 100% 97% 95.9% None (many diffs) n/a
2 ccsbBroad304_12235 pLX_304 0% 97% 95.9% V5 (many diffs) n/a
3 TRCN0000475638 ACCGTCTACTATACCACAAGTACC pLX_317 32.9% 97% 95.9% V5 (many diffs) n/a
Download CSV