Transcript: Human NM_001017958.2

Homo sapiens OS9 endoplasmic reticulum lectin (OS9), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
OS9 (10956)
Length:
2824
CDS:
208..2166

Additional Resources:

NCBI RefSeq record:
NM_001017958.2
NBCI Gene record:
OS9 (10956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150737 GCGGATTTGATTCGATTCATA pLKO.1 1294 CDS 100% 5.625 7.875 N OS9 n/a
2 TRCN0000157692 CCCTGCGGATTTGATTCGATT pLKO.1 1290 CDS 100% 4.950 6.930 N OS9 n/a
3 TRCN0000156713 GCATCGTCTTAAACGCTACCA pLKO.1 699 CDS 100% 2.640 3.696 N OS9 n/a
4 TRCN0000156741 GCTATTCACTTCCAGCGTGAA pLKO.1 442 CDS 100% 0.405 0.567 N OS9 n/a
5 TRCN0000157242 CGTGGTGATTGTCTCCTCTAA pLKO.1 384 CDS 100% 4.950 3.960 N OS9 n/a
6 TRCN0000156486 CAGAAAGAGCTGGAGAGCAAT pLKO.1 2080 CDS 100% 4.950 3.465 N OS9 n/a
7 TRCN0000154199 CAGCAATACCACATGGAAGAT pLKO.1 592 CDS 100% 4.950 3.465 N OS9 n/a
8 TRCN0000152720 CCACATGGAAGATTCAGAGAT pLKO.1 600 CDS 100% 4.950 3.465 N OS9 n/a
9 TRCN0000153402 GATGACAGTAAGGACTCAGAT pLKO.1 1117 CDS 100% 4.950 3.465 N OS9 n/a
10 TRCN0000156897 GATGCGTTATGGGATCGAGAT pLKO.1 321 CDS 100% 4.050 2.835 N OS9 n/a
11 TRCN0000428082 GAGGATGAGGATGAGGATGAA pLKO_005 1462 CDS 100% 4.950 2.475 Y TAF7L n/a
12 TRCN0000153022 GATGAGGATGAGGATGAAGAT pLKO.1 1465 CDS 100% 4.950 2.475 Y OS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017958.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02573 pDONR223 100% 89.5% 89.5% None 1361_1362ins45;1553_1717del n/a
2 ccsbBroad304_02573 pLX_304 0% 89.5% 89.5% V5 1361_1362ins45;1553_1717del n/a
3 TRCN0000466643 TTGCTAAATGCGACCGGAAGGATG pLX_317 19% 89.5% 89.5% V5 1361_1362ins45;1553_1717del n/a
4 ccsbBroadEn_07714 pDONR223 100% 89.4% 89.5% None 1056C>T;1361_1362ins45;1553_1717del n/a
5 ccsbBroad304_07714 pLX_304 0% 89.4% 89.5% V5 1056C>T;1361_1362ins45;1553_1717del n/a
6 TRCN0000469945 CTAGCTCGCTAATATATAACGAAA pLX_317 23.9% 89.4% 89.5% V5 1056C>T;1361_1362ins45;1553_1717del n/a
Download CSV