Transcript: Human NM_001018038.2

Homo sapiens vacuolar protein sorting 13 homolog A (VPS13A), transcript variant D, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
VPS13A (23230)
Length:
10187
CDS:
261..9470

Additional Resources:

NCBI RefSeq record:
NM_001018038.2
NBCI Gene record:
VPS13A (23230)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382425 GAAGGTTTACAACGCATTATT pLKO_005 7737 CDS 100% 15.000 21.000 N VPS13A n/a
2 TRCN0000118767 GCGGTCTTTCAAGAAATGTAT pLKO.1 4758 CDS 100% 5.625 4.500 N VPS13A n/a
3 TRCN0000118769 CCGAGCATTCTACAGTTATTA pLKO.1 7447 CDS 100% 15.000 10.500 N VPS13A n/a
4 TRCN0000118771 GCAGGATTGTTCAGTAAATAT pLKO.1 2873 CDS 100% 15.000 10.500 N VPS13A n/a
5 TRCN0000118768 GCCTTCAGAAACTGAAATAAA pLKO.1 3521 CDS 100% 15.000 10.500 N VPS13A n/a
6 TRCN0000380706 ATCGAAAGCATCCACCTAATT pLKO_005 6958 CDS 100% 13.200 9.240 N VPS13A n/a
7 TRCN0000122024 GCTTCTTGAATCAGTTGATAT pLKO.1 1160 CDS 100% 13.200 9.240 N VPS13A n/a
8 TRCN0000118770 GCAGAGAAGAAGCTAAAGATT pLKO.1 8614 CDS 100% 5.625 3.938 N VPS13A n/a
9 TRCN0000121638 GCTTAGTTTCTGGATTTGTTA pLKO.1 9157 CDS 100% 5.625 3.938 N VPS13A n/a
10 TRCN0000379951 TGTGGTCATGGAAGCATATTA pLKO_005 1306 CDS 100% 15.000 9.000 N VPS13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018038.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.