Transcript: Human NM_001018091.6

Homo sapiens GRINL1A complex locus 1 (GCOM1), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-16
Taxon:
Homo sapiens (human)
Gene:
GCOM1 (145781)
Length:
4457
CDS:
132..1469

Additional Resources:

NCBI RefSeq record:
NM_001018091.6
NBCI Gene record:
GCOM1 (145781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018091.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134571 GCAACAGAAACAGCTCTTAAT pLKO.1 1274 CDS 100% 13.200 6.600 Y GCOM1 n/a
2 TRCN0000135128 CAAAGATGTGAGAGCCACTTT pLKO.1 443 CDS 100% 4.950 2.475 Y GCOM1 n/a
3 TRCN0000134001 CAACTTCAACTCCTAGAACAT pLKO.1 1080 CDS 100% 4.950 2.475 Y GCOM1 n/a
4 TRCN0000138422 CAGCAGGAGTATCTGGAGAAT pLKO.1 555 CDS 100% 4.950 2.475 Y GCOM1 n/a
5 TRCN0000138600 CCAGTTCCTGAGCAATGTGAA pLKO.1 249 CDS 100% 4.950 2.475 Y GCOM1 n/a
6 TRCN0000135816 CGTCATCAACTGCAACTTCAA pLKO.1 1068 CDS 100% 4.950 2.475 Y GCOM1 n/a
7 TRCN0000133649 GTATGGAGACTATGATGAGAT pLKO.1 485 CDS 100% 4.950 2.475 Y GCOM1 n/a
8 TRCN0000135892 GCAGAAAGAAATGGTGGTGTA pLKO.1 380 CDS 100% 4.050 2.025 Y GCOM1 n/a
9 TRCN0000138860 GCAGACGTATGAAGCATCCAT pLKO.1 719 CDS 100% 3.000 1.500 Y GCOM1 n/a
10 TRCN0000136109 CAGGAACTATCAGTTTCCCAT pLKO.1 531 CDS 100% 2.640 1.320 Y GCOM1 n/a
11 TRCN0000138530 CCAGCAGAAGAAAGTCAAGCA pLKO.1 1217 CDS 100% 2.640 1.320 Y GCOM1 n/a
12 TRCN0000347784 CAAAGCAGGTTGGACTATTTG pLKO_005 1347 CDS 100% 13.200 6.600 Y Myzap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018091.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489235 GAGAGCCCGCTGGTGTCTGCATAG pLX_317 25.7% 93.5% 92.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV