Transcript: Human NM_001018111.3

Homo sapiens podocalyxin like (PODXL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PODXL (5420)
Length:
5986
CDS:
270..1946

Additional Resources:

NCBI RefSeq record:
NM_001018111.3
NBCI Gene record:
PODXL (5420)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296029 AGCCACGTAAGGGACTTTATA pLKO_005 2198 3UTR 100% 15.000 21.000 N PODXL n/a
2 TRCN0000296031 CTCGGGACATGACCATCTTAT pLKO_005 878 CDS 100% 13.200 18.480 N PODXL n/a
3 TRCN0000117019 GTCGTCAAAGAAATCACTATT pLKO.1 1494 CDS 100% 13.200 18.480 N PODXL n/a
4 TRCN0000288781 GTCGTCAAAGAAATCACTATT pLKO_005 1494 CDS 100% 13.200 18.480 N PODXL n/a
5 TRCN0000117021 CGTCATCGGTTATCTCGCAAA pLKO.1 1072 CDS 100% 4.050 5.670 N PODXL n/a
6 TRCN0000310117 ACGAGCGGCTGAAGGACAAAT pLKO_005 1543 CDS 100% 13.200 9.240 N PODXL n/a
7 TRCN0000117017 CCACCTTTACTGGGTTCTAAA pLKO.1 4467 3UTR 100% 13.200 9.240 N PODXL n/a
8 TRCN0000296030 ACTTCCAAGGCCAACGAAATC pLKO_005 471 CDS 100% 10.800 7.560 N PODXL n/a
9 TRCN0000117020 CATCGGTTATCTCGCAAAGAA pLKO.1 1075 CDS 100% 5.625 3.938 N PODXL n/a
10 TRCN0000117018 GAGAAATTGATCTCACTGATA pLKO.1 1389 CDS 100% 4.950 3.465 N PODXL n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1051 CDS 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1051 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018111.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06746 pDONR223 100% 94.2% 94% None 231G>A;707_802del n/a
2 ccsbBroad304_06746 pLX_304 0% 94.2% 94% V5 231G>A;707_802del n/a
3 TRCN0000476281 AGCTGATAATTAAGCTTACCCTCA pLX_317 22.8% 94.2% 94% V5 231G>A;707_802del n/a
Download CSV