Transcript: Human NM_001018161.1

Homo sapiens paraoxonase 2 (PON2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
PON2 (5445)
Length:
1633
CDS:
122..1150

Additional Resources:

NCBI RefSeq record:
NM_001018161.1
NBCI Gene record:
PON2 (5445)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051647 GCTGCTCATAGGCACTTTATA pLKO.1 1102 CDS 100% 15.000 21.000 N PON2 n/a
2 TRCN0000051644 GCACTCAGAAATCGACTTAAA pLKO.1 188 CDS 100% 13.200 18.480 N PON2 n/a
3 TRCN0000051643 GCACATTTCTATGCCACAAAT pLKO.1 608 CDS 100% 13.200 9.240 N PON2 n/a
4 TRCN0000291074 GCACATTTCTATGCCACAAAT pLKO_005 608 CDS 100% 13.200 9.240 N PON2 n/a
5 TRCN0000051645 CCACTACTTCTCTGATCCTTT pLKO.1 631 CDS 100% 4.950 3.465 N PON2 n/a
6 TRCN0000055029 CGACTTAAAGCCTCCAGAGAA pLKO.1 200 CDS 100% 4.950 3.465 N Pon2 n/a
7 TRCN0000051646 GACTACAGTTTATGCCAACAA pLKO.1 1033 CDS 100% 4.950 3.465 N PON2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018161.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11045 pDONR223 100% 58.3% 57% None (many diffs) n/a
2 ccsbBroad304_11045 pLX_304 0% 58.3% 57% V5 (many diffs) n/a
3 TRCN0000467502 AGCTTCCAACACCTCCGAGACAGT pLX_317 71.3% 58.3% 57% V5 (many diffs) n/a
Download CSV