Transcript: Mouse NM_001024709.3

Mus musculus keratin associated protein 10-10 (Krtap10-10), mRNA.

Source:
NCBI, updated 2016-09-16
Taxon:
Mus musculus (mouse)
Gene:
Krtap10-10 (544710)
Length:
1305
CDS:
53..706

Additional Resources:

NCBI RefSeq record:
NM_001024709.3
NBCI Gene record:
Krtap10-10 (544710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000270449 TCTGAGGCCTCACCAGAATAT pLKO_005 909 3UTR 100% 13.200 9.240 N Krtap10-10 n/a
2 TRCN0000270467 AGACTTCAGGGAGACACTTTC pLKO_005 1079 3UTR 100% 10.800 7.560 N Krtap10-10 n/a
3 TRCN0000270450 GCTTCACGTGGTATGAGTTAC pLKO_005 950 3UTR 100% 10.800 7.560 N Krtap10-10 n/a
4 TRCN0000270402 TGCCTTTCCACTGGCTATTTG pLKO_005 1008 3UTR 100% 13.200 7.920 N Krtap10-10 n/a
5 TRCN0000262748 TGTTTGTTGCACACCTGTCTG pLKO_005 385 CDS 100% 4.050 2.025 Y Gm3285 n/a
6 TRCN0000262750 CCTCATGCTGCCAGCAGTCTA pLKO_005 309 CDS 100% 1.650 0.825 Y Gm3285 n/a
7 TRCN0000282418 TCTGCTGCACACCTGTCTGTT pLKO_005 402 CDS 100% 4.950 2.475 Y Gm3285 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024709.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.