Transcript: Human NM_001025252.3

Homo sapiens tumor protein D52 (TPD52), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
TPD52 (7163)
Length:
4423
CDS:
378..1052

Additional Resources:

NCBI RefSeq record:
NM_001025252.3
NBCI Gene record:
TPD52 (7163)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162266 CAAGCGGAAACTTGGAATCAA pLKO.1 698 CDS 100% 5.625 3.938 N TPD52 n/a
2 TRCN0000164921 GCAGAGATCAAGCGGAAACTT pLKO.1 690 CDS 100% 5.625 3.938 N TPD52 n/a
3 TRCN0000344211 GCAGAGATCAAGCGGAAACTT pLKO_005 690 CDS 100% 5.625 3.938 N TPD52 n/a
4 TRCN0000159699 GCCTACAATGTTGTATTTGTT pLKO.1 2288 3UTR 100% 5.625 3.938 N TPD52 n/a
5 TRCN0000159738 GAAGAGCTAAGAAGAGAACTT pLKO.1 606 CDS 100% 4.950 3.465 N TPD52 n/a
6 TRCN0000344287 GAAGAGCTAAGAAGAGAACTT pLKO_005 606 CDS 100% 4.950 3.465 N TPD52 n/a
7 TRCN0000161353 GAAGCATCTAGCAGAGATCAA pLKO.1 680 CDS 100% 4.950 3.465 N TPD52 n/a
8 TRCN0000344288 GAAGCATCTAGCAGAGATCAA pLKO_005 680 CDS 100% 4.950 3.465 N TPD52 n/a
9 TRCN0000159877 GCTAAGAAGAGAACTTGCAAA pLKO.1 611 CDS 100% 4.950 3.465 N TPD52 n/a
10 TRCN0000158761 GCTTACAAGAAGACATCTGAA pLKO.1 780 CDS 100% 4.950 3.465 N TPD52 n/a
11 TRCN0000011854 GTTGGCTCAGTCATCACCAAA pLKO.1 846 CDS 100% 4.950 3.465 N Tpd52 n/a
12 TRCN0000159552 CCCTCTTTGAATCTCTGTATA pLKO.1 1429 3UTR 100% 13.200 7.920 N TPD52 n/a
13 TRCN0000159219 CCTCTTTGAATCTCTGTATAT pLKO.1 1430 3UTR 100% 13.200 7.920 N TPD52 n/a
14 TRCN0000166692 CCTGAGGAAGGAGAAGATGTT pLKO.1 540 CDS 100% 4.950 2.970 N TPD52 n/a
15 TRCN0000344286 CCTGAGGAAGGAGAAGATGTT pLKO_005 540 CDS 100% 4.950 2.970 N TPD52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025252.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01697 pDONR223 100% 81.3% 79.4% None (many diffs) n/a
2 ccsbBroad304_01697 pLX_304 0% 81.3% 79.4% V5 (many diffs) n/a
3 TRCN0000478943 CTATCCAACCGCCATGACGAGAGT pLX_317 61.1% 81.3% 79.4% V5 (many diffs) n/a
Download CSV