Transcript: Mouse NM_001025256.2

Mus musculus myelin basic protein (Mbp), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Mbp (17196)
Length:
2063
CDS:
118..582

Additional Resources:

NCBI RefSeq record:
NM_001025256.2
NBCI Gene record:
Mbp (17196)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375538 ACCCTCACAGCGATCCAAGTA pLKO_005 135 CDS 100% 4.950 3.960 N Mbp n/a
2 TRCN0000090246 GACGAGCTTCAGACCATCCAA pLKO.1 61 5UTR 100% 3.000 2.400 N Mbp n/a
3 TRCN0000090247 ACAGCAAGTACCATGGACCAT pLKO.1 163 CDS 100% 2.640 2.112 N Mbp n/a
4 TRCN0000375536 GGGAGGACAACACCTTCAAAG pLKO_005 23 5UTR 100% 10.800 7.560 N Mbp n/a
5 TRCN0000116261 CCTGGCCACAGCAAGTACCAT pLKO.1 156 CDS 100% 1.000 0.600 N MBP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025256.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00981 pDONR223 100% 20.3% 19.7% None (many diffs) n/a
2 ccsbBroad304_00981 pLX_304 0% 20.3% 19.7% V5 (many diffs) n/a
3 TRCN0000481619 TTCGGATGTTAAATAACATACGCA pLX_317 75.9% 20.3% 19.7% V5 (many diffs) n/a
Download CSV