Transcript: Mouse NM_001025371.2

Mus musculus serine incorporator 4 (Serinc4), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Serinc4 (574418)
Length:
2570
CDS:
212..1690

Additional Resources:

NCBI RefSeq record:
NM_001025371.2
NBCI Gene record:
Serinc4 (574418)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243708 TGTCTGCCTGGCCGGAATAAA pLKO_005 1166 CDS 100% 15.000 12.000 N Serinc4 n/a
2 TRCN0000243707 TCTTCCCAGCCTGGCATTATA pLKO_005 726 CDS 100% 15.000 10.500 N Serinc4 n/a
3 TRCN0000243706 CAGCACGGTGGAGTCAGTAAT pLKO_005 266 CDS 100% 13.200 9.240 N Serinc4 n/a
4 TRCN0000243705 GCTTCACATTCATCCTATTAC pLKO_005 762 CDS 100% 13.200 9.240 N Serinc4 n/a
5 TRCN0000183911 CCTCCTACAAGCCTCTATCAT pLKO.1 1057 CDS 100% 5.625 3.938 N Serinc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025371.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10185 pDONR223 100% 43.4% 36.6% None (many diffs) n/a
2 ccsbBroad304_10185 pLX_304 0% 43.4% 36.6% V5 (many diffs) n/a
3 TRCN0000476501 GTAGCGGCTTAACGCTTCAAGGTT pLX_317 47.2% 43.4% 36.6% V5 (many diffs) n/a
Download CSV