Transcript: Mouse NM_001025392.1

Mus musculus BCL2-associated transcription factor 1 (Bclaf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Bclaf1 (72567)
Length:
5454
CDS:
251..3010

Additional Resources:

NCBI RefSeq record:
NM_001025392.1
NBCI Gene record:
Bclaf1 (72567)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084414 CGCCGTAAAGAGAGAAGTAAA pLKO.1 2342 CDS 100% 13.200 18.480 N Bclaf1 n/a
2 TRCN0000302150 CGCCGTAAAGAGAGAAGTAAA pLKO_005 2342 CDS 100% 13.200 18.480 N Bclaf1 n/a
3 TRCN0000084415 GCCGGTCATATAGATCCTCTA pLKO.1 639 CDS 100% 4.050 5.670 N Bclaf1 n/a
4 TRCN0000331806 GCCGGTCATATAGATCCTCTA pLKO_005 639 CDS 100% 4.050 5.670 N Bclaf1 n/a
5 TRCN0000084416 GCGGTTCACTTCATACCAGAA pLKO.1 2134 CDS 100% 4.050 5.670 N Bclaf1 n/a
6 TRCN0000302224 GCGGTTCACTTCATACCAGAA pLKO_005 2134 CDS 100% 4.050 5.670 N Bclaf1 n/a
7 TRCN0000084417 CCCAAGTACAAGTCCAAAGTT pLKO.1 1550 CDS 100% 5.625 3.938 N Bclaf1 n/a
8 TRCN0000302225 CCCAAGTACAAGTCCAAAGTT pLKO_005 1550 CDS 100% 5.625 3.938 N Bclaf1 n/a
9 TRCN0000084413 GCAGAACTTGACACTTACATT pLKO.1 3031 3UTR 100% 5.625 3.938 N Bclaf1 n/a
10 TRCN0000302152 GCAGAACTTGACACTTACATT pLKO_005 3031 3UTR 100% 5.625 3.938 N Bclaf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.