Transcript: Human NM_001029840.2

Homo sapiens T cell activation inhibitor, mitochondrial (TCAIM), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-03-21
Taxon:
Homo sapiens (human)
Gene:
TCAIM (285343)
Length:
2021
CDS:
246..458

Additional Resources:

NCBI RefSeq record:
NM_001029840.2
NBCI Gene record:
TCAIM (285343)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001029840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

No results found.

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029840.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05395 pDONR223 100% 13.3% 12% None (many diffs) n/a
2 ccsbBroad304_05395 pLX_304 0% 13.3% 12% V5 (many diffs) n/a
3 TRCN0000481354 ACCCGTTTCTTCACCTAGCTGTCC pLX_317 35.1% 13.3% 12% V5 (many diffs) n/a
Download CSV