Transcript: Human NM_001031680.2

Homo sapiens RUNX family transcription factor 3 (RUNX3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUNX3 (864)
Length:
4340
CDS:
440..1729

Additional Resources:

NCBI RefSeq record:
NM_001031680.2
NBCI Gene record:
RUNX3 (864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235676 GTTCAACGACCTTCGCTTCGT pLKO_005 883 CDS 100% 2.640 3.696 N RUNX3 n/a
2 TRCN0000013672 CGAGAACTACTCCGCTGAGCT pLKO.1 823 CDS 100% 0.880 1.232 N RUNX3 n/a
3 TRCN0000235675 ACCACCTCTACTACGGGACAT pLKO_005 1470 CDS 100% 4.050 3.240 N RUNX3 n/a
4 TRCN0000235674 GGCTAGCAGCATGCGGTATTT pLKO_005 3400 3UTR 100% 13.200 9.240 N RUNX3 n/a
5 TRCN0000235673 ACCTCGGAACTGAACCCATTC pLKO_005 1187 CDS 100% 6.000 4.200 N RUNX3 n/a
6 TRCN0000013668 CCCAGCACTTTGTAGTCTCAT pLKO.1 3801 3UTR 100% 4.950 3.465 N RUNX3 n/a
7 TRCN0000235672 TGGCAGGCAATGACGAGAACT pLKO_005 810 CDS 100% 4.950 3.465 N RUNX3 n/a
8 TRCN0000013670 CCAAGGCACCTCGGAACTGAA pLKO.1 1180 CDS 100% 1.650 1.155 N RUNX3 n/a
9 TRCN0000013669 CGCCTTCAAGGTGGTGGCATT pLKO.1 754 CDS 100% 1.350 0.945 N RUNX3 n/a
10 TRCN0000084880 CCGCCAGTTTGACCGCTCCTT pLKO.1 1216 CDS 100% 0.000 0.000 N Runx3 n/a
11 TRCN0000013671 CGACCGCTCACCTACCCGCAT pLKO.1 1540 CDS 100% 0.000 0.000 N RUNX3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00230 pDONR223 100% 100% 100% None n/a
2 TRCN0000476916 CACTGAACTGGTGGTGTTCGACGC pLX_317 18.9% 100% 100% V5 n/a
Download CSV