Transcript: Human NM_001031700.3

Homo sapiens golgi associated kinase 1B (GASK1B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
GASK1B (51313)
Length:
4899
CDS:
383..1966

Additional Resources:

NCBI RefSeq record:
NM_001031700.3
NBCI Gene record:
GASK1B (51313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122105 CTTGATAAAGTGTATTGGGAA pLKO.1 1829 CDS 100% 2.640 3.696 N GASK1B n/a
2 TRCN0000144477 CAAAGATGACATCCGAAGAAT pLKO.1 1033 CDS 100% 5.625 3.938 N GASK1B n/a
3 TRCN0000142881 CCAAGATGGCACTCTTTGATT pLKO.1 1500 CDS 100% 5.625 3.938 N GASK1B n/a
4 TRCN0000145274 GACAGGAGTGAAGATAACTTA pLKO.1 1709 CDS 100% 5.625 3.938 N GASK1B n/a
5 TRCN0000142542 GAGCAGGAAAGCAGAGTTCAT pLKO.1 1267 CDS 100% 4.950 3.465 N GASK1B n/a
6 TRCN0000145204 GCTCACATTCATGTACTACTT pLKO.1 3593 3UTR 100% 4.950 3.465 N GASK1B n/a
7 TRCN0000122851 GAAAGCATGACCCAAGGCATT pLKO.1 1659 CDS 100% 4.050 2.835 N GASK1B n/a
8 TRCN0000144959 GTAATAGAACACAGAGCCAAA pLKO.1 1889 CDS 100% 4.050 2.835 N GASK1B n/a
9 TRCN0000141919 CGGCAGAAACTTCTTCAGTCT pLKO.1 1802 CDS 100% 2.640 1.584 N GASK1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031700.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11972 pDONR223 100% 44.4% 42.1% None (many diffs) n/a
2 ccsbBroad304_11972 pLX_304 0% 44.4% 42.1% V5 (many diffs) n/a
3 TRCN0000466219 GCATTGATCAACGAAACTATTGGT pLX_317 62.7% 44.4% 42.1% V5 (many diffs) n/a
Download CSV