Transcript: Human NM_001031714.4

Homo sapiens inverted formin, FH2 and WH2 domain containing (INF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-18
Taxon:
Homo sapiens (human)
Gene:
INF2 (64423)
Length:
7566
CDS:
132..3854

Additional Resources:

NCBI RefSeq record:
NM_001031714.4
NBCI Gene record:
INF2 (64423)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031714.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160696 CGACACGCTAAGTTTATGTTT pLKO.1 6534 3UTR 100% 5.625 7.875 N LOC388022 n/a
2 TRCN0000163725 GCGACACGCTAAGTTTATGTT pLKO.1 6533 3UTR 100% 5.625 7.875 N LOC388022 n/a
3 TRCN0000437773 AGCTGCGGAACGAGTTTATCG pLKO_005 778 CDS 100% 4.950 6.930 N INF2 n/a
4 TRCN0000123012 CGTGATCAACGCCGTCATCTT pLKO.1 728 CDS 100% 4.950 6.930 N INF2 n/a
5 TRCN0000438698 GATGCCCTCTGTGGTCAACTA pLKO_005 260 CDS 100% 4.950 6.930 N INF2 n/a
6 TRCN0000166634 CTTAGTGAGGTGGTCTAGCAT pLKO.1 7354 3UTR 100% 3.000 4.200 N LOC388022 n/a
7 TRCN0000120505 CATCTTCCTGAAGCAATTTAA pLKO.1 2057 CDS 100% 15.000 10.500 N Inf2 n/a
8 TRCN0000164679 CCAAGCCTCTATCTGACATCT pLKO.1 7388 3UTR 100% 4.950 3.465 N LOC388022 n/a
9 TRCN0000123013 CCGCTTCAGCATTGTCATGAA pLKO.1 659 CDS 100% 4.950 3.465 N INF2 n/a
10 TRCN0000123011 CCTGGACACATCCAACGTGAT pLKO.1 524 CDS 100% 4.050 2.835 N INF2 n/a
11 TRCN0000165983 GCCTCTATCTGACATCTGCTA pLKO.1 7392 3UTR 100% 2.640 1.848 N LOC388022 n/a
12 TRCN0000123010 GTACCGCTTCAGCATTGTCAT pLKO.1 656 CDS 100% 0.000 0.000 N INF2 n/a
13 TRCN0000120504 TCCTGGTATGTGGATGCCATT pLKO.1 3360 CDS 100% 4.050 2.835 N Inf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031714.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08855 pDONR223 100% 18.8% 18.8% None 105C>T;702_3720delinsG n/a
2 ccsbBroad304_08855 pLX_304 0% 18.8% 18.8% V5 105C>T;702_3720delinsG n/a
Download CSV