Transcript: Human NM_001031722.4

Homo sapiens alpha tubulin acetyltransferase 1 (ATAT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ATAT1 (79969)
Length:
1738
CDS:
331..1560

Additional Resources:

NCBI RefSeq record:
NM_001031722.4
NBCI Gene record:
ATAT1 (79969)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263600 GCGAGAACTCTTCCAGTATAT pLKO_005 702 CDS 100% 13.200 10.560 N ATAT1 n/a
2 TRCN0000263597 GATGATCGTGAGGCTCATAAT pLKO_005 616 CDS 100% 13.200 9.240 N ATAT1 n/a
3 TRCN0000167761 GTGAACAACTTTGTGATCTTT pLKO.1 832 CDS 100% 5.625 3.938 N ATAT1 n/a
4 TRCN0000194424 CCCACAGGTGAACAACTTTGT pLKO.1 825 CDS 100% 4.950 3.465 N Atat1 n/a
5 TRCN0000282709 CAGCAAATTATGACCATTATA pLKO_005 415 CDS 100% 15.000 9.000 N ATAT1 n/a
6 TRCN0000172948 GAAGGCTTCTTTGCCCATCAA pLKO.1 853 CDS 100% 4.950 2.970 N ATAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10521 pDONR223 100% 43.3% 42% None (many diffs) n/a
2 ccsbBroad304_10521 pLX_304 0% 43.3% 42% V5 (many diffs) n/a
3 TRCN0000466770 CACCAGTATCGGGACTCGTTCTGC pLX_317 71.4% 43.3% 42% V5 (many diffs) n/a
Download CSV