Transcript: Human NM_001031743.3

Homo sapiens cilia and flagella associated protein 206 (CFAP206), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CFAP206 (154313)
Length:
2207
CDS:
124..1992

Additional Resources:

NCBI RefSeq record:
NM_001031743.3
NBCI Gene record:
CFAP206 (154313)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138548 CGGGTCCTAGAGTCTAGATTA pLKO.1 430 CDS 100% 13.200 18.480 N CFAP206 n/a
2 TRCN0000134156 CAGCATATTGATTACCAGCTT pLKO.1 793 CDS 100% 2.640 3.696 N CFAP206 n/a
3 TRCN0000135274 CCGGAAGATTATCAGCTATGT pLKO.1 516 CDS 100% 4.950 3.465 N CFAP206 n/a
4 TRCN0000133934 CAACATCACAAGTCTTTCCTA pLKO.1 1067 CDS 100% 3.000 2.100 N CFAP206 n/a
5 TRCN0000135194 CGACAATATGAGGTCTTCCTT pLKO.1 931 CDS 100% 3.000 2.100 N CFAP206 n/a
6 TRCN0000136131 GCAGCATATTGATTACCAGCT pLKO.1 792 CDS 100% 2.160 1.512 N CFAP206 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09709 pDONR223 100% 99.9% 100% None 1428A>G n/a
2 ccsbBroad304_09709 pLX_304 0% 99.9% 100% V5 1428A>G n/a
Download CSV