Transcript: Human NM_001032998.2

Homo sapiens kynureninase (KYNU), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
KYNU (8942)
Length:
1778
CDS:
93..1016

Additional Resources:

NCBI RefSeq record:
NM_001032998.2
NBCI Gene record:
KYNU (8942)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001032998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051372 GCACTTTAATATTCCTGCCAT pLKO.1 779 CDS 100% 2.640 2.112 N KYNU n/a
2 TRCN0000431602 TGGTGTTCCTACAAGTATTTA pLKO_005 906 CDS 100% 15.000 10.500 N KYNU n/a
3 TRCN0000430390 ACTACAACTTCACGGACTTAA pLKO_005 617 CDS 100% 13.200 9.240 N KYNU n/a
4 TRCN0000051370 CCTCCAGTTGATTTATCATTA pLKO.1 255 CDS 100% 13.200 9.240 N KYNU n/a
5 TRCN0000424571 GGACAAGCGAAGGGTTGTTAT pLKO_005 810 CDS 100% 13.200 9.240 N KYNU n/a
6 TRCN0000051371 GCCATCTATTTCTTGGGAAAT pLKO.1 294 CDS 100% 1.080 0.756 N KYNU n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001032998.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02052 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02052 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472118 GGGCGCATCCCAGTACGAATTCCG pLX_317 45.9% 100% 100% V5 n/a
Download CSV