Transcript: Human NM_001033082.3

Homo sapiens MYCL proto-oncogene, bHLH transcription factor (MYCL), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MYCL (4610)
Length:
3158
CDS:
30..1214

Additional Resources:

NCBI RefSeq record:
NM_001033082.3
NBCI Gene record:
MYCL (4610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220176 CAGGAACTACGCCTCCATCAT pLKO.1 368 CDS 100% 4.950 6.930 N MYCL n/a
2 TRCN0000220174 CGAGGACATCTGGAAGAAATT pLKO.1 197 CDS 100% 13.200 7.920 N MYCL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033082.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10980 pDONR223 100% 46% 41.5% None (many diffs) n/a
2 ccsbBroad304_10980 pLX_304 0% 46% 41.5% V5 (many diffs) n/a
3 TRCN0000470501 TTTGTCGTAGTGGCAGAGCGTGAG pLX_317 70% 46% 41.5% V5 (many diffs) n/a
Download CSV