Transcript: Mouse NM_001033288.3

Mus musculus somatomedin B and thrombospondin, type 1 domain containing (Sbspon), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sbspon (226866)
Length:
2748
CDS:
71..865

Additional Resources:

NCBI RefSeq record:
NM_001033288.3
NBCI Gene record:
Sbspon (226866)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090894 GTCGAGTAGAACAGTGCTCAT pLKO.1 813 CDS 100% 4.050 5.670 N Sbspon n/a
2 TRCN0000090896 CTTCATAACTAGCTCTGTCTT pLKO.1 487 CDS 100% 4.950 3.465 N Sbspon n/a
3 TRCN0000090895 GCCCTTGCTTTGTGGGAGAAT pLKO.1 288 CDS 100% 4.950 3.465 N Sbspon n/a
4 TRCN0000090897 TGCTGGATACTGTATGGAGTT pLKO.1 565 CDS 100% 4.050 2.835 N Sbspon n/a
5 TRCN0000090893 GCCACTGAGAAAGAACATTTA pLKO.1 989 3UTR 100% 13.200 7.920 N Sbspon n/a
6 TRCN0000113857 GCTGGATACTGTATGGAGTTT pLKO.1 566 CDS 100% 4.950 3.465 N SBSPON n/a
7 TRCN0000113860 GCTATGAACTCTGTGAGCCTT pLKO.1 695 CDS 100% 2.640 1.848 N SBSPON n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13303 pDONR223 100% 85.8% 87.8% None (many diffs) n/a
2 ccsbBroad304_13303 pLX_304 0% 85.8% 87.8% V5 (many diffs) n/a
3 TRCN0000476921 CTCTTCCACAATTAAGATATCTAA pLX_317 42.5% 85.8% 87.8% V5 (many diffs) n/a
Download CSV