Transcript: Mouse NM_001033350.3

Mus musculus B cell scaffold protein with ankyrin repeats 1 (Bank1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Bank1 (242248)
Length:
3268
CDS:
128..2479

Additional Resources:

NCBI RefSeq record:
NM_001033350.3
NBCI Gene record:
Bank1 (242248)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242017 CAAGCGTGAGATACCATATTA pLKO_005 1069 CDS 100% 15.000 21.000 N Bank1 n/a
2 TRCN0000242018 ACCCAAACTATATAGGTTATT pLKO_005 2807 3UTR 100% 13.200 18.480 N Bank1 n/a
3 TRCN0000191812 GCGAAATTCTAGAGGTTGAAT pLKO.1 792 CDS 100% 5.625 7.875 N Bank1 n/a
4 TRCN0000216309 GTGTTAGCACCACAATTTATT pLKO.1 2617 3UTR 100% 15.000 12.000 N Bank1 n/a
5 TRCN0000216469 GATAATGTTCTTGCATCTATA pLKO.1 1046 CDS 100% 13.200 10.560 N Bank1 n/a
6 TRCN0000242020 GATAATGTTCTTGCATCTATA pLKO_005 1046 CDS 100% 13.200 10.560 N Bank1 n/a
7 TRCN0000257145 ATGAACTAATTGGCGAAATTC pLKO_005 780 CDS 100% 13.200 9.240 N Bank1 n/a
8 TRCN0000242019 CAGATCCTTTCTATCAGTTAT pLKO_005 489 CDS 100% 13.200 9.240 N Bank1 n/a
9 TRCN0000200751 GCTCTATACTTGAGAGAAATA pLKO.1 248 CDS 100% 13.200 9.240 N Bank1 n/a
10 TRCN0000200888 CCACTGTGATGGAATCATCAA pLKO.1 919 CDS 100% 0.495 0.347 N Bank1 n/a
11 TRCN0000143933 CCTTACATAGCTCAAGTGTTT pLKO.1 2009 CDS 100% 4.950 2.970 N BANK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033350.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.