Transcript: Human NM_001033504.1

Homo sapiens transmembrane protein 98 (TMEM98), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
TMEM98 (26022)
Length:
1732
CDS:
383..1063

Additional Resources:

NCBI RefSeq record:
NM_001033504.1
NBCI Gene record:
TMEM98 (26022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001033504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243374 CAGCTGTGTGTGCATAGTAAA pLKO_005 1176 3UTR 100% 13.200 18.480 N TMEM98 n/a
2 TRCN0000178773 CGCTATGATTCTAAGCCCATT pLKO.1 500 CDS 100% 4.050 5.670 N TMEM98 n/a
3 TRCN0000243377 CAGGAGCAGTCTGCAATTTAG pLKO_005 1043 CDS 100% 13.200 9.240 N TMEM98 n/a
4 TRCN0000243375 TAGCTTCTGAGCCAGATAAAG pLKO_005 996 CDS 100% 13.200 9.240 N TMEM98 n/a
5 TRCN0000243376 CCAGTGTCAGCGACATCATTG pLKO_005 750 CDS 100% 10.800 7.560 N TMEM98 n/a
6 TRCN0000243373 GAACTGGACGATGTCGTTATC pLKO_005 569 CDS 100% 10.800 7.560 N TMEM98 n/a
7 TRCN0000180675 CACCATCTTTCTGGCTTCGTT pLKO.1 421 CDS 100% 3.000 2.100 N TMEM98 n/a
8 TRCN0000181089 CCACTGCATTGCCATCTTGAA pLKO.1 658 CDS 100% 4.950 2.970 N TMEM98 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02905 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02905 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474182 ATCCAGACCCGACATCTAAACTCT pLX_317 63.3% 100% 100% V5 n/a
Download CSV